ansA Gene Page

Genbank name: ansA
EcoGene name: ansA
Divergent gene:
Species with an ortholog: EC   PA   SP   ST   VC   YP   
EcoGene link: EG10045

Species that contributed to the solution: EC PA
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 3.59
Model logo: ansA.1.model.LGO.gif
Sequence logo: ansA.1.LGO.gif
Sequence Alignment: ansA.1.ALGN
Solution location in genomic coordinates: 1848732-1848750
Solution sequence with flanking nucleotides: tgagt GGCCGACAGATCGTCGGCC acatt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1848764-1848782
Solution sequence with flanking nucleotides: tttta CGTCGACGAATCCTCTTCC cgctg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 3.34
Model logo: ansA.2.model.LGO.gif
Sequence logo: ansA.2.LGO.gif
Sequence Alignment: ansA.2.ALGN
Solution location in genomic coordinates: 1848851-1848872
Solution sequence with flanking nucleotides: tatac TTTTGCTCTTTCGATATCATTC atatc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 2.24
Model logo: ansA.3.model.LGO.gif
Sequence logo: ansA.3.LGO.gif
Sequence Alignment: ansA.3.ALGN
Solution location in genomic coordinates: 1848820-1848836
Solution sequence with flanking nucleotides: agtat CAGGTGCGCTCCCCCTG cctca
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page