ansB Gene Page
Genbank name: ansB
EcoGene name: ansB
Divergent gene:
Species with an ortholog:
EC HI ST YP
EcoGene link: EG10046
Reported site,genomic coordinates and site type: DPInteract 3098851:3098872 crp
Reported site,genomic coordinates and site type: DPInteract 3098801:3098822 fnr
Species that contributed to the solution: EC HI ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 8.21
Model logo: ansB.1.model.LGO.gif
Sequence logo: ansB.1.LGO.gif
Sequence Alignment: ansB.1.ALGN
Solution location in genomic coordinates: 3098837-3098856 R
Solution sequence with flanking nucleotides: gcctc TAACTTTGTAGATCTCCAAA atata
Number of overlapping basepairs with reported site: 6
Site type: crp
Species that contributed to the solution: EC HI
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 7.80
Model logo: ansB.2.model.LGO.gif
Sequence logo: ansB.2.LGO.gif
Sequence Alignment: ansB.2.ALGN
Solution location in genomic coordinates: 3098901-3098924 R
Solution sequence with flanking nucleotides: t AATCCTCTATTTTAAGACGGCATA atact
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ansB_yggN_IR     Overlap: 13
Solution location in genomic coordinates: 3098780-3098803 R
Solution sequence with flanking nucleotides: tcaaa TTTCCCATACAGAGCTAAGGGATA atgcg
Number of overlapping basepairs with reported site: 3
Site type: fnr
Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 7.44
Model logo: ansB.3.model.LGO.gif
Sequence logo: ansB.3.LGO.gif
Sequence Alignment: ansB.3.ALGN
Solution location in genomic coordinates: 3098895-3098918 R
Solution sequence with flanking nucleotides: atcct CTATTTTAAGACGGCATAATACTT tttta
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ansB_yggN_IR     Overlap: 19
Solution location in genomic coordinates: 3098815-3098838 R
Solution sequence with flanking nucleotides: ctcca AAATATATTCACGTTGTAAATTGT ttaac
Number of overlapping basepairs with reported site: 8
Site type: fnr
Gene Index Page