ansP Gene Page
Genbank name: ansP
EcoGene name: ansP
Divergent gene: yncG
Species with an ortholog:
EC ST YP
EcoGene link: EG13776
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 7.20
Model logo: ansP.1.model.LGO.gif
Sequence logo: ansP.1.LGO.gif
Sequence Alignment: ansP.1.ALGN
Solution location in genomic coordinates: 1524235-1524257 R
Solution sequence with flanking nucleotides: cacaa TCTTTTAAAGATTAAGTGTAGGA cagta
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1524125-1524147 R
Solution sequence with flanking nucleotides: ttgca TCGTTTATCGATAACGGGTAGGA tgctg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 7.02
Model logo: ansP.2.model.LGO.gif
Sequence logo: ansP.2.LGO.gif
Sequence Alignment: ansP.2.ALGN
Solution location in genomic coordinates: 1524069-1524092 R
Solution sequence with flanking nucleotides: aagaa TAATGGTGATAACTATCATCGCCA ggatg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 3.95
Model logo: ansP.3.model.LGO.gif
Sequence logo: ansP.3.LGO.gif
Sequence Alignment: ansP.3.ALGN
Solution location in genomic coordinates: 1524164-1524183 R
Solution sequence with flanking nucleotides: ttgta TTAATCCCCTTCAGGATTGT aaggg
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page