apbA Gene Page

Genbank name: apbA
EcoGene name: apbA
Divergent gene: yajQ
Species with an ortholog: EC PA SP ST VC YP
EcoGene link: EG13271

Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 9.77
Model logo: apbA.1.model.LGO.gif
Sequence logo: apbA.1.LGO.gif
Sequence Alignment: apbA.1.ALGN
Solution location in genomic coordinates: 443863-443881 R
Solution sequence with flanking nucleotides: ttgat GCGAAGCATAATACCCGCA aagtt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 443784-443802 R
Solution sequence with flanking nucleotides: gcaac AGCATGCACAATTAAGGGA tagcc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: apbA_yajQ_IR Overlap: 19

Species that contributed to the solution: EC PA SP ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 8.26
Model logo: apbA.2.model.LGO.gif
Sequence logo: apbA.2.LGO.gif
Sequence Alignment: apbA.2.ALGN
Solution location in genomic coordinates: 443747-443770 R
Solution sequence with flanking nucleotides: ttgaa CACCCGGAGTGGTTGCGGGTGAGG aggaa
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page