aphA Gene Page
Genbank name: aphA
EcoGene name: aphA
Divergent gene:
Species with an ortholog:
EC HI ST
EcoGene link: EG11934
Species that contributed to the solution: EC HI ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 7.89
Model logo: aphA.1.model.LGO.gif
Sequence logo: aphA.1.LGO.gif
Sequence Alignment: aphA.1.ALGN
Solution location in genomic coordinates: 4266958-4266981
Solution sequence with flanking nucleotides: caata AAAAGTTTCAACATACTGACTATT taggg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC HI ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 7.43
Model logo: aphA.2.model.LGO.gif
Sequence logo: aphA.2.LGO.gif
Sequence Alignment: aphA.2.ALGN
Solution location in genomic coordinates: 4266883-4266906
Solution sequence with flanking nucleotides: cacaa AAACCGCAGATAATCCTTCCTTTC cccgg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 6.64
Model logo: aphA.3.model.LGO.gif
Sequence logo: aphA.3.LGO.gif
Sequence Alignment: aphA.3.ALGN
Solution location in genomic coordinates: 4266915-4266930
Solution sequence with flanking nucleotides: ggcag CTGGCGTTATGGTCAG atggt
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page