appC Gene Page

---

Species that contributed to the solution: EC SP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 5.26
Model logo: appC.2.model.LGO.gif
Sequence logo: appC.2.LGO.gif
Sequence Alignment: appC.2.ALGN
Solution location in genomic coordinates: 1036829-1036852
Solution sequence with flanking nucleotides: ta AAAAGACGGTAAGTATCGCTTTCA gtctt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1036903-1036926
Solution sequence with flanking nucleotides: tcagg ATAAAGAGGGAGATCTACCATTAT cgggt
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 3.91
Model logo: appC.3.model.LGO.gif
Sequence logo: appC.3.LGO.gif
Sequence Alignment: appC.3.ALGN
Solution location in genomic coordinates: 1036863-1036886
Solution sequence with flanking nucleotides: atgaa TATCGCAATCGGCGAATACCTCTG gtcgt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1036918-1036941
Solution sequence with flanking nucleotides: agatc TACCATTATCGGGTTATTTTTCTC tcttc
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page