apt Gene Page

Genbank name: apt
EcoGene name: apt
Divergent gene:
Species with an ortholog: AA   EC   HI   PA   SP   ST   VC   YP   
EcoGene link: EG10051

Species that contributed to the solution: AA EC PA SP ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 13.62
Model logo: apt.1.model.LGO.gif
Sequence logo: apt.1.LGO.gif
Sequence Alignment: apt.1.ALGN
Solution location in genomic coordinates: 490538-490561
Solution sequence with flanking nucleotides: cgttt TCGAGCACAGGCGCAGGCGGTCAA aggtt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 12.03
Model logo: apt.2.model.LGO.gif
Sequence logo: apt.2.LGO.gif
Sequence Alignment: apt.2.ALGN
Solution location in genomic coordinates: 490515-490536
Solution sequence with flanking nucleotides: tgcgt ACAGCCAGTACATTCTGGCGTT ttcga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI PA ST VC
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 10.51
Model logo: apt.3.model.LGO.gif
Sequence logo: apt.3.LGO.gif
Sequence Alignment: apt.3.ALGN
Solution location in genomic coordinates: 490488-490511
Solution sequence with flanking nucleotides: aagca CAACAATCGCAGTTGCAATTATTG cgtac
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page