aqpZ Gene Page

Genbank name: aqpZ
EcoGene name: aqpZ
Divergent gene: ybjD
Species with an ortholog: EC   PA   SP   TF   
EcoGene link: EG13270

Species that contributed to the solution: EC TF
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 7.26
Model logo: aqpZ.1.model.LGO.gif
Sequence logo: aqpZ.1.LGO.gif
Sequence Alignment: aqpZ.1.ALGN
Solution location in genomic coordinates: 915506-915528 R
Solution sequence with flanking nucleotides: aatca AATAATTAGCATGATAAATTATT tttta
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 915379-915401 R
Solution sequence with flanking nucleotides: actgg ATTTATTTATCTGGTGAATGACT cgcct
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA SP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 6.38
Model logo: aqpZ.2.model.LGO.gif
Sequence logo: aqpZ.2.LGO.gif
Sequence Alignment: aqpZ.2.ALGN
Solution location in genomic coordinates: 915508-915527 R
Solution sequence with flanking nucleotides: atcaa ATAATTAGCATGATAAATTA ttttt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 915286-915305 R
Solution sequence with flanking nucleotides: accat ATTTTTCACAGGGTCAATTT ttaat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA SP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 2.18
Model logo: aqpZ.3.model.LGO.gif
Sequence logo: aqpZ.3.LGO.gif
Sequence Alignment: aqpZ.3.ALGN
Solution location in genomic coordinates: 915394-915412 R
Solution sequence with flanking nucleotides: aaatc AAATTTACTGGATTTATTT atctg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 915346-915364 R
Solution sequence with flanking nucleotides: tttta AAATAGCCGCGCATTATTT ccgtc
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page