araB Gene Page
Genbank name: araB
EcoGene name: araB
Divergent gene: araC
Species with an ortholog:
EC ST YP
EcoGene link: EG10053
Reported site,genomic coordinates and site type: DPInteract 70107:70154 araC
Reported site,genomic coordinates and site type: DPInteract 70181:70228 araC
Reported site,genomic coordinates and site type: DPInteract 70158:70179 crp
Reported site,genomic coordinates and site type: DPInteract 70196:70217 crp
Reported site,genomic coordinates and site type: DPInteract 70118:70152 soxS
Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 11.28
Model logo: araB.1.model.LGO.gif
Sequence logo: araB.1.LGO.gif
Sequence Alignment: araB.1.ALGN
Solution location in genomic coordinates: 70341-70361 R
Solution sequence with flanking nucleotides: tcaga GAAGAAACCAATTGTCCATAT tgcat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 70174-70194 R
Solution sequence with flanking nucleotides: ggcag AAAAGTCCACATTGATTATTT gcacg
Number of overlapping basepairs with reported site: 14
Site type: araC crp
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 10.57
Model logo: araB.2.model.LGO.gif
Sequence logo: araB.2.LGO.gif
Sequence Alignment: araB.2.ALGN
Solution location in genomic coordinates: 70057-70080 R
Solution sequence with flanking nucleotides: gtttc TCCATACCCGTTTTTTTGGATGGA gtgaa
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 10.56
Model logo: araB.3.model.LGO.gif
Sequence logo: araB.3.LGO.gif
Sequence Alignment: araB.3.ALGN
Solution location in genomic coordinates: 70155-70173 R
Solution sequence with flanking nucleotides: tattt GCACGGCGTCACACTTTGC tatgc
Number of overlapping basepairs with reported site: 16
Site type: crp
Gene Index Page