araC Gene Page
Genbank name: araC
EcoGene name: araC
Divergent gene: araB
Species with an ortholog:
EC ST YP
EcoGene link: EG10054
Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 11.34
Model logo: araC.1.model.LGO.gif
Sequence logo: araC.1.LGO.gif
Sequence Alignment: araC.1.ALGN
Solution location in genomic coordinates: 70174-70194
Solution sequence with flanking nucleotides: cgtgc AAATAATCAATGTGGACTTTT ctgcc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 70341-70361
Solution sequence with flanking nucleotides: atgca ATATGGACAATTGGTTTCTTC tctga
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 10.92
Model logo: araC.2.model.LGO.gif
Sequence logo: araC.2.LGO.gif
Sequence Alignment: araC.2.ALGN
Solution location in genomic coordinates: 70057-70080
Solution sequence with flanking nucleotides: ttcac TCCATCCAAAAAAACGGGTATGGA gaaac
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 8.78
Model logo: araC.3.model.LGO.gif
Sequence logo: araC.3.LGO.gif
Sequence Alignment: araC.3.ALGN
Solution location in genomic coordinates: 70155-70173
Solution sequence with flanking nucleotides: gcata GCAAAGTGTGACGCCGTGC aaata
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page