araD Gene Page

Repeat: REPv6e     Overlap: 14
Solution location in genomic coordinates: 66580-66596 R
Solution sequence with flanking nucleotides: gcgat TTTGTAGGCCGGATAAG caaag
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REPv6a     Overlap: 14

---

Species that contributed to the solution: EC
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 2
Map value: 17.45
Model logo: araD.2.model.LGO.gif
Sequence logo: araD.2.LGO.gif
Sequence Alignment: araD.2.ALGN
Solution location in genomic coordinates: 66721-66741 R
Solution sequence with flanking nucleotides: agcgc ATCCGGCATTCAACGCCTGAT gcgac
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REP6d     Overlap: 7
Repeat: REPv6e     Overlap: 7
Solution location in genomic coordinates: 66636-66656 R
Solution sequence with flanking nucleotides: agcgc ATCCGGCATTCAACGCCTGAT gcgac
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REP6b     Overlap: 7
Repeat: REPv6c     Overlap: 7

---

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 17.06
Model logo: araD.3.model.LGO.gif
Sequence logo: araD.3.LGO.gif
Sequence Alignment: araD.3.ALGN
Solution location in genomic coordinates: 66750-66766 R
Solution sequence with flanking nucleotides: gcgat TTTGTAGGCCGGATAAG caaag
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REPv6e     Overlap: 14
Solution location in genomic coordinates: 66665-66681 R
Solution sequence with flanking nucleotides: gcgat TTTGTAGGCCGGATAAG caaag
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REPv6c     Overlap: 14


Gene Index Page