araE Gene Page

Genbank name: araE
EcoGene name: araE
Divergent gene:
Species with an ortholog: EC   ST   
EcoGene link: EG10056
   Reported site,genomic coordinates and site type: DPInteract 2980263:2980310 araC
   Reported site,genomic coordinates and site type: PMID:6319708/RegulonDB 2980314:2980346 crp

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 11.81
Model logo: araE.1.model.LGO.gif
Sequence logo: araE.1.LGO.gif
Sequence Alignment: araE.1.ALGN
Solution location in genomic coordinates: 2980414-2980435 R
Solution sequence with flanking nucleotides: ttatg AAATAATCCATATTAATTATCA attaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2980277-2980298 R
Solution sequence with flanking nucleotides: cagca ATTTAATCCATATTTATGCTGT ttccg
Number of overlapping basepairs with reported site: 22
Site type: araC

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 8.93
Model logo: araE.2.model.LGO.gif
Sequence logo: araE.2.LGO.gif
Sequence Alignment: araE.2.ALGN
Solution location in genomic coordinates: 2980347-2980368 R
Solution sequence with flanking nucleotides: tggtt AATAATAATCTCAATAATTCAA cttaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2980314-2980335 R
Solution sequence with flanking nucleotides: ttgaa AATTGGAATATCCATCACATAA cgaca
Number of overlapping basepairs with reported site: 22
Site type: crp

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 7.23
Model logo: araE.3.model.LGO.gif
Sequence logo: araE.3.LGO.gif
Sequence Alignment: araE.3.ALGN
Solution location in genomic coordinates: 2980476-2980499 R
Solution sequence with flanking nucleotides: tttta TGACCCTGCCGCATGGCAGGGTTT tttat
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: TERM47     Overlap: 24


Gene Index Page