araF Gene Page
Genbank name: araF
EcoGene name: araF
Divergent gene: ftnB
Species with an ortholog:
EC YP
EcoGene link: EG10057
Reported site,genomic coordinates and site type: DPInteract 1984316:1984363 araC
Reported site,genomic coordinates and site type: DPInteract 1984391:1984438 araC
Reported site,genomic coordinates and site type: PMID:2231717/RegulonDB 1984293:1984314 crp
Species that contributed to the solution: EC YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 5.68
Model logo: araF.1.model.LGO.gif
Sequence logo: araF.1.LGO.gif
Sequence Alignment: araF.1.ALGN
Solution location in genomic coordinates: 1984230-1984251 R
Solution sequence with flanking nucleotides: gtcac TTATCTTTTAGTTAAAAGGTAA tgctt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1984200-1984221 R
Solution sequence with flanking nucleotides: tttgt TTTCCGATTAATTTAACGAATG tcatt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: araF_ftnB_IR1     Overlap: 8
Species that contributed to the solution: EC YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 3.86
Model logo: araF.2.model.LGO.gif
Sequence logo: araF.2.LGO.gif
Sequence Alignment: araF.2.ALGN
Solution location in genomic coordinates: 1984370-1984388 R
Solution sequence with flanking nucleotides: ttcga CAATTTGTCTGACAAATTG gcttt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: araF_ftnB_IR2     Overlap: 19
Solution location in genomic coordinates: 1984267-1984285 R
Solution sequence with flanking nucleotides: agaat TAATTTCTCGCTAAAACTA tgtca
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 2.20
Model logo: araF.3.model.LGO.gif
Sequence logo: araF.3.LGO.gif
Sequence Alignment: araF.3.ALGN
Solution location in genomic coordinates: 1984337-1984358 R
Solution sequence with flanking nucleotides: cctta TGTCTTTTCCCGCTAAATTTAT gcacg
Number of overlapping basepairs with reported site: 22
Site type: araC
Solution location in genomic coordinates: 1984266-1984287 R
Solution sequence with flanking nucleotides: ggaga ATTAATTTCTCGCTAAAACTAT gtcaa
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page