araG Gene Page

Genbank name: araG
EcoGene name: araG
Divergent gene:
Species with an ortholog: EC   YP   
EcoGene link: EG10058

Species that contributed to the solution: EC
Total number of sites in the solution: 1
Number of E. coli sites in the solution: 1
Map value: 5.28
Model logo: araG.1.model.LGO.gif
Sequence logo:
Sequence Alignment: araG.1.ALGN
Solution location in genomic coordinates: 1983127-1983143 R
Solution sequence with flanking nucleotides: ttccc CTCTGCATGATGCAGAG ggggt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: araG_araF_IR     Overlap: 17
Solution location in genomic coordinates: 1983148-1983163 R
Solution sequence with flanking nucleotides: t AATTTGCCGGAAAAAT tcccc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1983102-1983121 R
Solution sequence with flanking nucleotides: ggggt GTGAACGACCAGTGATTCAC ggaga
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page