araJ Gene Page
Genbank name: araJ
EcoGene name: araJ
Divergent gene:
Species with an ortholog:
EC PA ST YP
EcoGene link: EG10060
Reported site,genomic coordinates and site type: DPInteract 411785:411832 araC
Reported site,genomic coordinates and site type: PMID:2231717/RegulonDB 411829:411861 crp
Reported site,genomic coordinates and site type: PMID:2231717/RegulonDB 411707:411729 crp
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 7.13
Model logo: araJ.1.model.LGO.gif
Sequence logo: araJ.1.LGO.gif
Sequence Alignment: araJ.1.ALGN
Solution location in genomic coordinates: 411784-411802 R
Solution sequence with flanking nucleotides: agagg GGCGAATTATCTCTTGGCC ttgct
Number of overlapping basepairs with reported site: 18
Site type: araC
Solution location in genomic coordinates: 411745-411763 R
Solution sequence with flanking nucleotides: ctgca AGCTATCACTTTATTGGCT acggt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 3.20
Model logo: araJ.2.model.LGO.gif
Sequence logo: araJ.2.LGO.gif
Sequence Alignment: araJ.2.ALGN
Solution location in genomic coordinates: 411809-411829 R
Solution sequence with flanking nucleotides: taac TATTCAGCAGGATAATGAATA cagag
Number of overlapping basepairs with reported site: 21
Site type: araC crp
Species that contributed to the solution: EC PA ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 1.22
Model logo: araJ.3.model.LGO.gif
Sequence logo: araJ.3.LGO.gif
Sequence Alignment: araJ.3.ALGN
Solution location in genomic coordinates: 411727-411744 R
Solution sequence with flanking nucleotides: tggct ACGGTGATTGGTAGCCGT tctgg
Number of overlapping basepairs with reported site: 3
Site type: crp
Gene Index Page