arcA Gene Page

Solution location in genomic coordinates: 4637885-4637907 R
Solution sequence with flanking nucleotides: tcctg TTTCGATTTAGTTGGCAATTTAG gtagc
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC HI SP ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 24.25
Model logo: arcA.2.model.LGO.gif
Sequence logo: arcA.2.LGO.gif
Sequence Alignment: arcA.2.ALGN
Solution location in genomic coordinates: 4638181-4638199 R
Solution sequence with flanking nucleotides: gatga TTTCATCAAACTGTTAACG tgcta
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4638095-4638113 R
Solution sequence with flanking nucleotides: tagcc TGTTATGTTGCTGTTAAAA tggtt
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC HI SP ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 23.75
Model logo: arcA.3.model.LGO.gif
Sequence logo: arcA.3.LGO.gif
Sequence Alignment: arcA.3.ALGN
Solution location in genomic coordinates: 4638302-4638325 R
Solution sequence with flanking nucleotides: ttctg TTTACTTAGGATAATTTTATAAAA aataa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4638149-4638172 R
Solution sequence with flanking nucleotides: tacaa TTGAACTTGATATATGTCAACGAA gcgta
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page