arcB Gene Page

Genbank name: arcB
EcoGene name: arcB
Divergent gene:
Species with an ortholog: EC ST VC YP
EcoGene link: EG10062

Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 6.96
Model logo: arcB.1.model.LGO.gif
Sequence logo: arcB.1.LGO.gif
Sequence Alignment: arcB.1.ALGN
Solution location in genomic coordinates: 3350690-3350706 R
Solution sequence with flanking nucleotides: actgt CAGAATTGGGTATTATT ggggc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC VC YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 3.37
Model logo: arcB.2.model.LGO.gif
Sequence logo: arcB.2.LGO.gif
Sequence Alignment: arcB.2.ALGN
Solution location in genomic coordinates: 3350711-3350733 R
Solution sequence with flanking nucleotides: cgcat TTCTCACACAATTTATAACGTAA ctgtc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 1.71
Model logo: arcB.3.model.LGO.gif
Sequence logo: arcB.3.LGO.gif
Sequence Alignment: arcB.3.ALGN
Solution location in genomic coordinates: 3350664-3350683 R
Solution sequence with flanking nucleotides: gggca GGTTGTCGTGAAGGAATTCC cta
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page