argA Gene Page
Genbank name: argA
EcoGene name: argA
Divergent gene: amiC
Species with an ortholog:
EC PA SP ST TF VC YP
EcoGene link: EG10063
Reported site,genomic coordinates and site type: DPInteract 2947215:2947232 argR
Reported site,genomic coordinates and site type: DPInteract 2947236:2947253 argR
Reported site,genomic coordinates and site type: DPInteract 2947215:2947253 argR2
Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 35.90
Model logo: argA.1.model.LGO.gif
Sequence logo: argA.1.LGO.gif
Sequence Alignment: argA.1.ALGN
Solution location in genomic coordinates: 2947125-2947148
Solution sequence with flanking nucleotides: ct AATAAACGGTAAACATTCTTTTTA tattc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2947212-2947235
Solution sequence with flanking nucleotides: gcgaa AAAACAGAATAAAAATACACTAAT ttcga
Number of overlapping basepairs with reported site: 21
Site type: argR argR2
Species that contributed to the solution: EC PA SP ST TF VC YP
Total number of sites in the solution: 11
Number of E. coli sites in the solution: 2
Map value: 24.60
Model logo: argA.2.model.LGO.gif
Sequence logo: argA.2.LGO.gif
Sequence Alignment: argA.2.ALGN
Solution location in genomic coordinates: 2947149-2947171
Solution sequence with flanking nucleotides: tttta TATTCACGGCATTACTGATAAAA aagtc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2947223-2947245
Solution sequence with flanking nucleotides: gaata AAAATACACTAATTTCGAATAAT catgc
Number of overlapping basepairs with reported site: 23
Site type: argR argR argR2
Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 16.32
Model logo: argA.3.model.LGO.gif
Sequence logo: argA.3.LGO.gif
Sequence Alignment: argA.3.ALGN
Solution location in genomic coordinates: 2947179-2947201
Solution sequence with flanking nucleotides: gtcgc TCTCGCATAAAATTTACACTTGC accct
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page