argC Gene Page

Genbank name: argC
EcoGene name: argC
Divergent gene: argE
Species with an ortholog: EC   PA   SP   ST   TF   VC   YP   
EcoGene link: EG10065
   Reported site,genomic coordinates and site type: DPInteract 4152453:4152470 argR
   Reported site,genomic coordinates and site type: DPInteract 4152474:4152491 argR

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 40.38
Model logo: argC.1.model.LGO.gif
Sequence logo: argC.1.LGO.gif
Sequence Alignment: argC.1.ALGN
Solution location in genomic coordinates: 4152459-4152481
Solution sequence with flanking nucleotides: atcaa TATTCATGCAGTATTTATGAATA aaaat
Number of overlapping basepairs with reported site: 12
Site type: argR argR

Species that contributed to the solution: EC SP ST TF YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 13.79
Model logo: argC.2.model.LGO.gif
Sequence logo: argC.2.LGO.gif
Sequence Alignment: argC.2.ALGN
Solution location in genomic coordinates: 4152427-4152449
Solution sequence with flanking nucleotides: TGTTGACACACCTCTGGTCATGA tagta
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4152483-4152505
Solution sequence with flanking nucleotides: aataa AAATACACTAACGTTGAGCGTAA taaaa
Number of overlapping basepairs with reported site: 9
Site type: argR

Species that contributed to the solution: EC SP ST TF VC
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 11.42
Model logo: argC.3.model.LGO.gif
Sequence logo: argC.3.LGO.gif
Sequence Alignment: argC.3.ALGN
Solution location in genomic coordinates: 4152483-4152506
Solution sequence with flanking nucleotides: aataa AAATACACTAACGTTGAGCGTAAT aaaac
Number of overlapping basepairs with reported site: 9
Site type: argR
Solution location in genomic coordinates: 4152508-4152531
Solution sequence with flanking nucleotides: taata AAACCCACCAGCCGTAAGGTGAAT gtttt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page