argD Gene Page

Genbank name: argD
EcoGene name: argD
Divergent gene:
Species with an ortholog: EC   PA   SP   ST   VC   
EcoGene link: EG10066
   Reported site,genomic coordinates and site type: DPInteract 3487869:3487886 argR
   Reported site,genomic coordinates and site type: DPInteract 3487848:3487865 argR
   Reported site,genomic coordinates and site type: DPInteract 3487848:3487886 argR2

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 18.27
Model logo: argD.1.model.LGO.gif
Sequence logo: argD.1.LGO.gif
Sequence Alignment: argD.1.ALGN
Solution location in genomic coordinates: 3487875-3487895 R
Solution sequence with flanking nucleotides: tctga TTGCCATTTAGTGATTTTTTA tgcat
Number of overlapping basepairs with reported site: 12
Site type: argR argR2
Solution location in genomic coordinates: 3487854-3487874 R
Solution sequence with flanking nucleotides: tttta TGCATATTTTGTGGTTATAAT ttcac
Number of overlapping basepairs with reported site: 21
Site type: argR argR argR2

Species that contributed to the solution: EC SP ST VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 17.17
Model logo: argD.2.model.LGO.gif
Sequence logo: argD.2.LGO.gif
Sequence Alignment: argD.2.ALGN
Solution location in genomic coordinates: 3487869-3487886 R
Solution sequence with flanking nucleotides: cattt AGTGATTTTTTATGCATA ttttg
Number of overlapping basepairs with reported site: 18
Site type: argR argR2
Solution location in genomic coordinates: 3487848-3487865 R
Solution sequence with flanking nucleotides: tattt TGTGGTTATAATTTCACA tttgt
Number of overlapping basepairs with reported site: 18
Site type: argR argR2

Species that contributed to the solution: EC SP ST VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 14.91
Model logo: argD.3.model.LGO.gif
Sequence logo: argD.3.LGO.gif
Sequence Alignment: argD.3.ALGN
Solution location in genomic coordinates: 3487852-3487872 R
Solution sequence with flanking nucleotides: ttatg CATATTTTGTGGTTATAATTT cacat
Number of overlapping basepairs with reported site: 21
Site type: argR argR argR2
Solution location in genomic coordinates: 3487828-3487848 R
Solution sequence with flanking nucleotides: ttcac ATTTGTTTATGCGTAACAGGG tgatc
Number of overlapping basepairs with reported site: 1
Site type: argR argR2


Gene Index Page