argE Gene Page

Genbank name: argE
EcoGene name: argE
Divergent gene: argC
Species with an ortholog: EC   PA   ST   VC   YP   
EcoGene link: EG11286

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 43.28
Model logo: argE.1.model.LGO.gif
Sequence logo: argE.1.LGO.gif
Sequence Alignment: argE.1.ALGN
Solution location in genomic coordinates: 4152472-4152489 R
Solution sequence with flanking nucleotides: gttag TGTATTTTTATTCATAAA tactg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4152451-4152468 R
Solution sequence with flanking nucleotides: aatac TGCATGAATATTGATACT atcat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 37.60
Model logo: argE.2.model.LGO.gif
Sequence logo: argE.2.LGO.gif
Sequence Alignment: argE.2.ALGN
Solution location in genomic coordinates: 4152459-4152481 R
Solution sequence with flanking nucleotides: atttt TATTCATAAATACTGCATGAATA ttgat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 10.31
Model logo: argE.3.model.LGO.gif
Sequence logo: argE.3.LGO.gif
Sequence Alignment: argE.3.ALGN
Solution location in genomic coordinates: 4152427-4152449 R
Solution sequence with flanking nucleotides: tacta TCATGACCAGAGGTGTGTCAACA
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page