argG Gene Page
Genbank name: argG
EcoGene name: argG
Divergent gene:
Species with an ortholog:
AA EC HI PA SP ST TF VC YP
EcoGene link: EG10068
Reported site,genomic coordinates and site type: DPInteract 3316188:3316205 argR
Reported site,genomic coordinates and site type: DPInteract 3316209:3316226 argR
Reported site,genomic coordinates and site type: DPInteract 3316069:3316086 argR
Reported site,genomic coordinates and site type: DPInteract 3316188:3316226 argR2
Species that contributed to the solution: AA EC HI SP ST
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 25.21
Model logo: argG.1.model.LGO.gif
Sequence logo: argG.1.LGO.gif
Sequence Alignment: argG.1.ALGN
Solution location in genomic coordinates: 3316201-3316224
Solution sequence with flanking nucleotides: aaaac TCATTTATTTTGCATAAAAATTCA gtgag
Number of overlapping basepairs with reported site: 24
Site type: argR argR argR2
Species that contributed to the solution: EC HI ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 23.16
Model logo: argG.2.model.LGO.gif
Sequence logo: argG.2.LGO.gif
Sequence Alignment: argG.2.ALGN
Solution location in genomic coordinates: 3315942-3315962
Solution sequence with flanking nucleotides: acgtg GCAAATTCTACTCGTTTTGGG taaaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3315971-3315991
Solution sequence with flanking nucleotides: aaaat GCAAATACTGCTGGGATTTGG tgtac
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI SP ST TF YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 2
Map value: 17.01
Model logo: argG.3.model.LGO.gif
Sequence logo: argG.3.LGO.gif
Sequence Alignment: argG.3.ALGN
Solution location in genomic coordinates: 3316028-3316049
Solution sequence with flanking nucleotides: attat AGTGATCCACGCCACATTTTGT caacg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3316188-3316209
Solution sequence with flanking nucleotides: agatg ATTAAATGAAAACTCATTTATT ttgca
Number of overlapping basepairs with reported site: 22
Site type: argR argR argR2
Gene Index Page