argH Gene Page

Genbank name: argH
EcoGene name: argH
Divergent gene:
Species with an ortholog: AA   EC   HI   PA   SP   ST   TF   VC   YP   
EcoGene link: EG11223

Species that contributed to the solution: EC HI SP ST TF VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 3.92
Model logo: argH.1.model.LGO.gif
Sequence logo: argH.1.LGO.gif
Sequence Alignment: argH.1.ALGN
Solution location in genomic coordinates: 4154392-4154415
Solution sequence with flanking nucleotides: gcagc TTTCCGGCATTGAATTTCAAAATA aggaa
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page