argI Gene Page

Genbank name: argI
EcoGene name: argI
Divergent gene: yjgD
Species with an ortholog: EC   ST   
EcoGene link: EG10069
   Reported site,genomic coordinates and site type: DPInteract 4475921:4475938 argR
   Reported site,genomic coordinates and site type: DPInteract 4475900:4475917 argR
   Reported site,genomic coordinates and site type: DPInteract 4475900:4475938 argR2
Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 29.38
Model logo: argI.1.model.LGO.gif
Sequence logo: argI.1.LGO.gif
Sequence Alignment: argI.1.ALGN
Solution location in genomic coordinates: 4475920-4475939 R
Solution sequence with flanking nucleotides: cttgc AAATGAATAATCATCCATAT aaatt
Number of overlapping basepairs with reported site: 19
Site type: argR argR2
Repeat: argI_yjgD_IR     Overlap: 19
Solution location in genomic coordinates: 4475899-4475918 R
Solution sequence with flanking nucleotides: atata AATTGAATTTTAATTCATTG aggcg
Number of overlapping basepairs with reported site: 19
Site type: argR argR2
Repeat: argI_yjgD_IR     Overlap: 19
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 12.65
Model logo: argI.2.model.LGO.gif
Sequence logo: argI.2.LGO.gif
Sequence Alignment: argI.2.ALGN
Solution location in genomic coordinates: 4475902-4475920 R
Solution sequence with flanking nucleotides: ccata TAAATTGAATTTTAATTCA ttgag
Number of overlapping basepairs with reported site: 19
Site type: argR argR2
Repeat: argI_yjgD_IR     Overlap: 19
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 12.11
Model logo: argI.3.model.LGO.gif
Sequence logo: argI.3.LGO.gif
Sequence Alignment: argI.3.ALGN
Solution location in genomic coordinates: 4475995-4476014 R
Solution sequence with flanking nucleotides: tgtcc TGCCGATACTCTTATTGTCA cacac
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page