argR Gene Page

Genbank name: argR
EcoGene name: argR
Divergent gene: mdh
Species with an ortholog: AA   EC   HI   SP   ST   VC   YP
EcoGene link: EG10070    Reported site,genomic coordinates and site type: DPInteract 3382276:3382293 argR
   Reported site,genomic coordinates and site type: DPInteract 3382296:3382313 argR

Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 42.75
Model logo: argR.1.model.LGO.gif
Sequence logo: argR.1.LGO.gif
Sequence Alignment: argR.1.ALGN
Solution location in genomic coordinates: 3382149-3382172
Solution sequence with flanking nucleotides: tcaat TTGATAACAATTAATTTACTTTTA agcag
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3382278-3382301
Solution sequence with flanking nucleotides: ctgtt TGCATAAAAATTCATCTGTATGCA caata
Number of overlapping basepairs with reported site: 16
Site type: argR argR

Species that contributed to the solution: AA EC HI ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 20.85
Model logo: argR.2.model.LGO.gif
Sequence logo: argR.2.LGO.gif
Sequence Alignment: argR.2.ALGN
Solution location in genomic coordinates: 3381916-3381938
Solution sequence with flanking nucleotides: tcctt ATTATATTGATAAACTAAGATAT gttgc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3382025-3382047
Solution sequence with flanking nucleotides: tagcg TTTATGCATTTAATTGCCGTAAT cagga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 1
Map value: 18.99
Model logo: argR.3.model.LGO.gif
Sequence logo: argR.3.LGO.gif
Sequence Alignment: argR.3.ALGN
Solution location in genomic coordinates: 3382222-3382244
Solution sequence with flanking nucleotides: aaatt TGATAAAATCCCGCTCTTTCATA acatt
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page