argS Gene Page

Genbank name: argS
EcoGene name: argS
Divergent gene: yecM
Species with an ortholog: EC HI PA SP ST TF VC YP
EcoGene link: EG10071

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 16.64
Model logo: argS.1.model.LGO.gif
Sequence logo: argS.1.LGO.gif
Sequence Alignment: argS.1.ALGN
Solution location in genomic coordinates: 1957892-1957913
Solution sequence with flanking nucleotides: tcagt AAAAGCGTTAATTTACCCTGTT gccct
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI SP ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 11.41
Model logo: argS.2.model.LGO.gif
Sequence logo: argS.2.LGO.gif
Sequence Alignment: argS.2.ALGN
Solution location in genomic coordinates: 1957893-1957913
Solution sequence with flanking nucleotides: cagta AAAGCGTTAATTTACCCTGTT gccct
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1957928-1957948
Solution sequence with flanking nucleotides: caacc AACCGCTGATTTCACGCCGCT tctga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI PA ST TF VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 9.38
Model logo: argS.3.model.LGO.gif
Sequence logo: argS.3.LGO.gif
Sequence Alignment: argS.3.ALGN
Solution location in genomic coordinates: 1957921-1957942
Solution sequence with flanking nucleotides: cctgt GCCAACCAACCGCTGATTTCAC gccgc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1958062-1958083
Solution sequence with flanking nucleotides: tgctc GCTTCATCAATGTAAGGTATTC cg
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page