argT Gene Page

Genbank name: argT
EcoGene name: argT
Divergent gene:
Species with an ortholog: EC   ST   YP   
EcoGene link: EG10072

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 17.45
Model logo: argT.1.model.LGO.gif
Sequence logo: argT.1.LGO.gif
Sequence Alignment: argT.1.ALGN
Solution location in genomic coordinates: 2426041-2426061 R
Solution sequence with flanking nucleotides: gccct GTTTCAGGGCAATTTTGCAAC cgcga
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2425942-2425962 R
Solution sequence with flanking nucleotides: cttca ACTTCAGGACAATAATGCAAC gtctt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 9.69
Model logo: argT.2.model.LGO.gif
Sequence logo: argT.2.LGO.gif
Sequence Alignment: argT.2.ALGN
Solution location in genomic coordinates: 2425917-2425935 R
Solution sequence with flanking nucleotides: tctta TTAACATATTTAACGTTGA atgtt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 9.49
Model logo: argT.3.model.LGO.gif
Sequence logo: argT.3.LGO.gif
Sequence Alignment: argT.3.ALGN
Solution location in genomic coordinates: 2425984-2426002 R
Solution sequence with flanking nucleotides: ttcaa TCGAAACGCTGCGATTCAA ccgct
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page