aroA Gene Page

Genbank name: aroA
EcoGene name: aroA
Divergent gene:
Species with an ortholog: AA EC HI PA SP ST TF VC YP
EcoGene link: EG10073

Species that contributed to the solution: EC PA ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 13.84
Model logo: aroA.1.model.LGO.gif
Sequence logo: aroA.1.LGO.gif
Sequence Alignment: aroA.1.ALGN
Solution location in genomic coordinates: 957985-958003
Solution sequence with flanking nucleotides: taatc CCCACAGCCAGCCTGTGGG gtttt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: serC_aroA_IR Overlap: 19

Species that contributed to the solution: AA EC HI PA TF VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 1
Map value: 11.16
Model logo: aroA.2.model.LGO.gif
Sequence logo: aroA.2.LGO.gif
Sequence Alignment: aroA.2.ALGN
Solution location in genomic coordinates: 957964-957983
Solution sequence with flanking nucleotides: ta ATGCCGAAATTTTGCTTAAT cccca
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: serC_aroA_IR Overlap: 3

Gene Index Page