aroB Gene Page

Genbank name: aroB
EcoGene name: aroB
Divergent gene:
Species with an ortholog: AA EC HI PA SP ST TF VC YP
EcoGene link: EG10074

Species that contributed to the solution: AA EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 8.52
Model logo: aroB.1.model.LGO.gif
Sequence logo: aroB.1.LGO.gif
Sequence Alignment: aroB.1.ALGN
Solution location in genomic coordinates: 3516126-3516145 R
Solution sequence with flanking nucleotides: acagt AATTAAGGTGGATGTCGCGT t
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA TF
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 5.79
Model logo: aroB.2.model.LGO.gif
Sequence logo: aroB.2.LGO.gif
Sequence Alignment: aroB.2.ALGN
Solution location in genomic coordinates: 3516148-3516169 R
Solution sequence with flanking nucleotides: cttta TATACACTCGTCTGCGGGTACA gtaat
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page