aroG Gene Page

Genbank name: aroG
EcoGene name: aroG
Divergent gene: ybgS
Species with an ortholog: AA   EC   HI   SP   ST   VC   YP   
EcoGene link: EG10079
   Reported site,genomic coordinates and site type: DPInteract 784766:784787 tyrR

Species that contributed to the solution: AA EC SP ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 22.09
Model logo: aroG.1.model.LGO.gif
Sequence logo: aroG.1.LGO.gif
Sequence Alignment: aroG.1.ALGN
Solution location in genomic coordinates: 784766-784787
Solution sequence with flanking nucleotides: ttcat AGTGTAAAACCCCGTTTACACA ttctg
Number of overlapping basepairs with reported site: 22
Site type: tyrR

Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 13.53
Model logo: aroG.2.model.LGO.gif
Sequence logo: aroG.2.LGO.gif
Sequence Alignment: aroG.2.ALGN
Solution location in genomic coordinates: 784806-784826
Solution sequence with flanking nucleotides: tatag ATTGGAAGTATTGCATTCACT aagat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 12.44
Model logo: aroG.3.model.LGO.gif
Sequence logo: aroG.3.LGO.gif
Sequence Alignment: aroG.3.ALGN
Solution location in genomic coordinates: 784564-784587
Solution sequence with flanking nucleotides: tcgtt ATGTCGGATAACCTCTTCCAACAG tgcat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 784654-784677
Solution sequence with flanking nucleotides: agaga ATCTTGAAATAATTAACAAACAAA ggagt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page