aroH Gene Page

Genbank name: aroH
EcoGene name: aroH
Divergent gene:
Species with an ortholog: EC SP ST VC YP
EcoGene link: EG10080

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 22.70
Model logo: aroH.1.model.LGO.gif
Sequence logo: aroH.1.LGO.gif
Sequence Alignment: aroH.1.ALGN
Solution location in genomic coordinates: 1786407-1786427
Solution sequence with flanking nucleotides: atgcg CATCACTTCCCGGCAGTCCTG ccgta
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 21.61
Model logo: aroH.2.model.LGO.gif
Sequence logo: aroH.2.LGO.gif
Sequence Alignment: aroH.2.ALGN
Solution location in genomic coordinates: 1786305-1786325
Solution sequence with flanking nucleotides: tagag AACTAGTGCATTAGCTTATTT ttttg
Number of overlapping basepairs with reported site: 12
Site type: trpR
Solution location in genomic coordinates: 1786438-1786458
Solution sequence with flanking nucleotides: gaagc AACAAATTTCTGAGACTTGTA
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 20.31
Model logo: aroH.3.model.LGO.gif
Sequence logo: aroH.3.LGO.gif
Sequence Alignment: aroH.3.ALGN
Solution location in genomic coordinates: 1786407-1786427
Solution sequence with flanking nucleotides: atgcg CATCACTTCCCGGCAGTCCTG ccgta
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1786438-1786458
Solution sequence with flanking nucleotides: gaagc AACAAATTTCTGAGACTTGTA
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page