aroK Gene Page

Genbank name: aroK
EcoGene name: aroK
Divergent gene:
Species with an ortholog: EC   ST   
EcoGene link: EG10081

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 11.89
Model logo: aroK.1.model.LGO.gif
Sequence logo: aroK.1.LGO.gif
Sequence Alignment: aroK.1.ALGN
Solution location in genomic coordinates: 3517076-3517095 R
Solution sequence with flanking nucleotides: agccg TAAAAGCGGTAATGTTTTTA cgctg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3517012-3517031 R
Solution sequence with flanking nucleotides: tagca TACAAGGAGTACCGATTTGA gagtt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: -0.38
Model logo: aroK.2.model.LGO.gif
Sequence logo: aroK.2.LGO.gif
Sequence Alignment: aroK.2.ALGN
Solution location in genomic coordinates: 3517045-3517068 R
Solution sequence with flanking nucleotides: ctgaa CGTGTTTCATCTATTTGACGCGCG caggt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page