aroL Gene Page

Genbank name: aroL
EcoGene name: aroL
Divergent gene:
Species with an ortholog: EC   ST   YP   
EcoGene link: EG10082
   Reported site,genomic coordinates and site type: DPInteract 405522:405543 tyrR
   Reported site,genomic coordinates and site type: DPInteract 405499:405520 tyrR
   Reported site,genomic coordinates and site type: DPInteract 405446:405467 tyrR

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 30.41
Model logo: aroL.1.model.LGO.gif
Sequence logo: aroL.1.LGO.gif
Sequence Alignment: aroL.1.ALGN
Solution location in genomic coordinates: 405448-405465
Solution sequence with flanking nucleotides: taaa TGTAATTTATTATTTACA cttca
Number of overlapping basepairs with reported site: 18
Site type: tyrR
Solution location in genomic coordinates: 405524-405541
Solution sequence with flanking nucleotides: ttaag TGGAATTTTTTCTTTACA atcga
Number of overlapping basepairs with reported site: 18
Site type: tyrR

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 7.22
Model logo: aroL.2.model.LGO.gif
Sequence logo: aroL.2.LGO.gif
Sequence Alignment: aroL.2.ALGN
Solution location in genomic coordinates: 405503-405521
Solution sequence with flanking nucleotides: gggtg TATTGAGATTTTCACTTTA agtgg
Number of overlapping basepairs with reported site: 18
Site type: tyrR

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 4.81
Model logo: aroL.3.model.LGO.gif
Sequence logo: aroL.3.LGO.gif
Sequence Alignment: aroL.3.ALGN
Solution location in genomic coordinates: 405549-405570
Solution sequence with flanking nucleotides: cgaaa TTGTACTAGTTTGATGGTATGA tcgct
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page