aroM Gene Page
Genbank name: aroM
EcoGene name: aroM
Divergent gene:
Species with an ortholog:
EC ST
EcoGene link: EG10083
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 10.55
Model logo: aroM.1.model.LGO.gif
Sequence logo: aroM.1.LGO.gif
Sequence Alignment: aroM.1.ALGN
Solution location in genomic coordinates: 406407-406426
Solution sequence with flanking nucleotides: agact GCTCGGAAGGGATTCTGAGT gccac
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 9.98
Model logo: aroM.2.model.LGO.gif
Sequence logo: aroM.2.LGO.gif
Sequence Alignment: aroM.2.ALGN
Solution location in genomic coordinates: 406406-406427
Solution sequence with flanking nucleotides: cagac TGCTCGGAAGGGATTCTGAGTG ccact
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 406516-406537
Solution sequence with flanking nucleotides: ggaat CATTTGGAATCTTTACATTATG ccgtg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 8.37
Model logo: aroM.3.model.LGO.gif
Sequence logo: aroM.3.LGO.gif
Sequence Alignment: aroM.3.ALGN
Solution location in genomic coordinates: 406554-406575
Solution sequence with flanking nucleotides: tgctg CTACGCTTTTTGTCATTTGTAG cacaa
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page