aroP Gene Page

Genbank name: aroP
EcoGene name: aroP
Divergent gene: pdhR
Species with an ortholog: EC   PA   ST   YP
EcoGene link: EG10084    Reported site,genomic coordinates and site type: DPInteract 121597:121618 tyrR
   Reported site,genomic coordinates and site type: DPInteract 121620:121641 tyrR

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 18.94
Model logo: aroP.1.model.LGO.gif
Sequence logo: aroP.1.LGO.gif
Sequence Alignment: aroP.1.ALGN
Solution location in genomic coordinates: 121622-121639 R
Solution sequence with flanking nucleotides: tttga TGTAAACAAATTAATACA acaaa
Number of overlapping basepairs with reported site: 18
Site type: tyrR

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 13.67
Model logo: aroP.2.model.LGO.gif
Sequence logo: aroP.2.LGO.gif
Sequence Alignment: aroP.2.ALGN
Solution location in genomic coordinates: 121819-121842 R
Solution sequence with flanking nucleotides: attca CTTACCAATTTTGTGATTTTTAAT tcaat
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: aroP_pdhR_IR1 Overlap: 7
Solution location in genomic coordinates: 121741-121764 R
Solution sequence with flanking nucleotides: ctgag CTTTACAAACGGTTTCTTTTTAAG caact
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 12.56
Model logo: aroP.3.model.LGO.gif
Sequence logo: aroP.3.LGO.gif
Sequence Alignment: aroP.3.ALGN
Solution location in genomic coordinates: 121864-121886 R
Solution sequence with flanking nucleotides: agttt TTTAACGATTATTAAACTATAAA aatcc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: aroP_pdhR_IR2 Overlap: 23
Solution location in genomic coordinates: 121811-121833 R
Solution sequence with flanking nucleotides: ccaat TTTGTGATTTTTAATTCAATTAA aacga
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: aroP_pdhR_IR1 Overlap: 15

Gene Index Page