arsR Gene Page

Genbank name: arsR
EcoGene name: arsR
Divergent gene:
Species with an ortholog: EC   PA   SP   VC   YP   
EcoGene link: EG12235

Species that contributed to the solution: EC PA SP VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 28.47
Model logo: arsR.1.model.LGO.gif
Sequence logo: arsR.1.LGO.gif
Sequence Alignment: arsR.1.ALGN
Solution location in genomic coordinates: 3646081-3646100
Solution sequence with flanking nucleotides: cttac ACATTCGTTAAGTCATATAT gtttt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 13.24
Model logo: arsR.2.model.LGO.gif
Sequence logo: arsR.2.LGO.gif
Sequence Alignment: arsR.2.ALGN
Solution location in genomic coordinates: 3645749-3645771
Solution sequence with flanking nucleotides: agtaa AAAACCGACGCAAAGTCGGTTTT tttac
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: TERM54     Overlap: 23
Solution location in genomic coordinates: 3645980-3646002
Solution sequence with flanking nucleotides: agtaa AAAACCGACGCAAAGTCGGTTTT tttac
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: TERM55     Overlap: 23

Species that contributed to the solution: EC VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 11.80
Model logo: arsR.3.model.LGO.gif
Sequence logo: arsR.3.LGO.gif
Sequence Alignment: arsR.3.ALGN
Solution location in genomic coordinates: 3645814-3645837
Solution sequence with flanking nucleotides: gaccc AGTGAAAGTATATAAATCGTCACT gcgat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3645915-3645938
Solution sequence with flanking nucleotides: atagt ATTGAGCTGTTAGATAAGAACTCT ctcac
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page