artJ Gene Page
Genbank name: artJ
EcoGene name: artJ
Divergent gene:
Species with an ortholog:
EC ST YP
EcoGene link: EG11628
Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 15.60
Model logo: artJ.1.model.LGO.gif
Sequence logo: artJ.1.LGO.gif
Sequence Alignment: artJ.1.ALGN
Solution location in genomic coordinates: 899868-899885 R
Solution sequence with flanking nucleotides: tgttt ATTGCATATAAATTCACT tgatg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 899848-899865 R
Solution sequence with flanking nucleotides: acttg ATGGCATTGTTATCCCAT gccgc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 13.72
Model logo: artJ.2.model.LGO.gif
Sequence logo: artJ.2.LGO.gif
Sequence Alignment: artJ.2.ALGN
Solution location in genomic coordinates: 899901-899919 R
Solution sequence with flanking nucleotides: ccgtc TTTTTTATTTCATTTAAAT tattt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: artJ_REPa_IR Overlap: 8
Solution location in genomic coordinates: 899873-899891 R
Solution sequence with flanking nucleotides: taatc ATGTTTATTGCATATAAAT tcact
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 9.43
Model logo: artJ.3.model.LGO.gif
Sequence logo: artJ.3.LGO.gif
Sequence Alignment: artJ.3.ALGN
Solution location in genomic coordinates: 899922-899944 R
Solution sequence with flanking nucleotides: gaaga CGGACAACCCACTAAGTTGTCCG tcttt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: artJ_REPa_IR Overlap: 23
Gene Index Page