artP Gene Page

Genbank name: artP
EcoGene name: artP
Divergent gene:
Species with an ortholog: EC HI ST VC YP
EcoGene link: EG11624

Species that contributed to the solution: EC HI ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 27.07
Model logo: artP.1.model.LGO.gif
Sequence logo: artP.1.LGO.gif
Sequence Alignment: artP.1.ALGN
Solution location in genomic coordinates: 903016-903038 R
Solution sequence with flanking nucleotides: ttaaa GCAGAAATATTGCATAATTATTC tgtca
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI ST VC YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 2
Map value: 22.98
Model logo: artP.2.model.LGO.gif
Sequence logo: artP.2.LGO.gif
Sequence Alignment: artP.2.ALGN
Solution location in genomic coordinates: 903063-903086 R
Solution sequence with flanking nucleotides: cgtta TTTTGTGCTATGTTTATTGAATAA tgcgc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 903022-903045 R
Solution sequence with flanking nucleotides: ttaac TTTTAAAGCAGAAATATTGCATAA ttatt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI ST VC
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 15.35
Model logo: artP.3.model.LGO.gif
Sequence logo: artP.3.LGO.gif
Sequence Alignment: artP.3.ALGN
Solution location in genomic coordinates: 903135-903156 R
Solution sequence with flanking nucleotides: caata AACCCCGTAAATTGTCCGGCAT ttcgt
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page