ascG Gene Page

Genbank name: ascG
EcoGene name: ascG
Divergent gene: ascF
Species with an ortholog: EC ST VC YP
EcoGene link: EG10087

Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 5.23
Model logo: ascG.1.model.LGO.gif
Sequence logo: ascG.1.LGO.gif
Sequence Alignment: ascG.1.ALGN
Solution location in genomic coordinates: 2837337-2837356 R
Solution sequence with flanking nucleotides: cccgc CGATTGTGCAAGGACAATCG gcaaa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ascG_ascF_IR Overlap: 20

Species that contributed to the solution: EC VC YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 4.14
Model logo: ascG.2.model.LGO.gif
Sequence logo: ascG.2.LGO.gif
Sequence Alignment: ascG.2.ALGN
Solution location in genomic coordinates: 2837523-2837538 R
Solution sequence with flanking nucleotides: atttt ATCCTGTTATCAGTAG ggtag
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2837499-2837514 R
Solution sequence with flanking nucleotides: agatg TAGTTGTTATCAGTCG acgtg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC VC YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 4.06
Model logo: ascG.3.model.LGO.gif
Sequence logo: ascG.3.LGO.gif
Sequence Alignment: ascG.3.ALGN
Solution location in genomic coordinates: 2837423-2837438 R
Solution sequence with flanking nucleotides: tcatg AATAGTTGTCACTAAA taagc
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page