aslB Gene Page

Genbank name: aslB
EcoGene name: aslB
Divergent gene:
Species with an ortholog: EC   ST   YP   
EcoGene link: EG10090

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 1.89
Model logo: aslB.1.model.LGO.gif
Sequence logo: aslB.1.LGO.gif
Sequence Alignment: aslB.1.ALGN
Solution location in genomic coordinates: 3980497-3980513
Solution sequence with flanking nucleotides: acgcc CGTAATAACTCATTGCC ccacg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 1.60
Model logo: aslB.2.model.LGO.gif
Sequence logo: aslB.2.LGO.gif
Sequence Alignment: aslB.2.ALGN
Solution location in genomic coordinates: 3980430-3980453
Solution sequence with flanking nucleotides: atttt GAACCCCGCTTCGGCGGGGTTTTT tgttt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: TERM59     Overlap: 24

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 0.43
Model logo: aslB.3.model.LGO.gif
Sequence logo: aslB.3.LGO.gif
Sequence Alignment: aslB.3.ALGN
Solution location in genomic coordinates: 3980516-3980539
Solution sequence with flanking nucleotides: gcccc ACGGTATGATTTCGCCCTTAACGT attga
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page