asnA Gene Page

Genbank name: asnA
EcoGene name: asnA
Divergent gene: asnC
Species with an ortholog: AA   EC   HI   ST   YP   
EcoGene link: EG10091

Species that contributed to the solution: AA EC ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 19.64
Model logo: asnA.1.model.LGO.gif
Sequence logo: asnA.1.LGO.gif
Sequence Alignment: asnA.1.ALGN
Solution location in genomic coordinates: 3924679-3924694
Solution sequence with flanking nucleotides: ttctt TTTTAATGAATCAAAA gtgag
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3924742-3924757
Solution sequence with flanking nucleotides: gtttt TGTTGCTTAATCATAA gcaac
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: asnC_asnA_IR     Overlap: 16

Species that contributed to the solution: AA EC HI ST YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 18.44
Model logo: asnA.2.model.LGO.gif
Sequence logo: asnA.2.LGO.gif
Sequence Alignment: asnA.2.ALGN
Solution location in genomic coordinates: 3924675-3924698
Solution sequence with flanking nucleotides: agcct TCTTTTTTAATGAATCAAAAGTGA gttag
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3924703-3924726
Solution sequence with flanking nucleotides: agtta GGCTTTTTATTGAATGATTATTGC atgtg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI ST YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 17.99
Model logo: asnA.3.model.LGO.gif
Sequence logo: asnA.3.LGO.gif
Sequence Alignment: asnA.3.ALGN
Solution location in genomic coordinates: 3924649-3924670
Solution sequence with flanking nucleotides: tgcgg ATTGATGATTCATTCTATTTTA gcctt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page