asnB Gene Page

Genbank name: asnB
EcoGene name: asnB
Divergent gene:
Species with an ortholog: EC   PA   SP   ST   TF   VC   YP   
EcoGene link: EG10092

Species that contributed to the solution: EC SP ST VC
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 7.50
Model logo: asnB.1.model.LGO.gif
Sequence logo: asnB.1.LGO.gif
Sequence Alignment: asnB.1.ALGN
Solution location in genomic coordinates: 698512-698528 R
Solution sequence with flanking nucleotides: tcacc AATCGACAATCACCATT acgtt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA ST TF VC
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 4.26
Model logo: asnB.2.model.LGO.gif
Sequence logo: asnB.2.LGO.gif
Sequence Alignment: asnB.2.ALGN
Solution location in genomic coordinates: 698712-698731 R
Solution sequence with flanking nucleotides: gctac GCTTATCAGGCCTACGCAGC tcctg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REPv61b     Overlap: 15

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 3.80
Model logo: asnB.3.model.LGO.gif
Sequence logo: asnB.3.LGO.gif
Sequence Alignment: asnB.3.ALGN
Solution location in genomic coordinates: 698557-698578 R
Solution sequence with flanking nucleotides: ctaaa AATTATCGATTCATCAATAAAT atatc
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page