asnC Gene Page

Genbank name: asnC
EcoGene name: asnC
Divergent gene: asnA
Species with an ortholog: EC   HI   SP   ST   VC   YP   
EcoGene link: EG10093

Species that contributed to the solution: EC HI SP ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 19.77
Model logo: asnC.1.model.LGO.gif
Sequence logo: asnC.1.LGO.gif
Sequence Alignment: asnC.1.ALGN
Solution location in genomic coordinates: 3924705-3924723 R
Solution sequence with flanking nucleotides: atgca ATAATCATTCAATAAAAAG cctaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3924677-3924695 R
Solution sequence with flanking nucleotides: actca CTTTTGATTCATTAAAAAA gaagg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI SP ST YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 18.82
Model logo: asnC.2.model.LGO.gif
Sequence logo: asnC.2.LGO.gif
Sequence Alignment: asnC.2.ALGN
Solution location in genomic coordinates: 3924741-3924761 R
Solution sequence with flanking nucleotides: tcctg TTGCTTATGATTAAGCAACAA aaacc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: asnC_asnA_IR     Overlap: 20
Solution location in genomic coordinates: 3924678-3924698 R
Solution sequence with flanking nucleotides: ctaac TCACTTTTGATTCATTAAAAA agaag
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI SP ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 1
Map value: 13.78
Model logo: asnC.3.model.LGO.gif
Sequence logo: asnC.3.LGO.gif
Sequence Alignment: asnC.3.ALGN
Solution location in genomic coordinates: 3924637-3924656 R
Solution sequence with flanking nucleotides: atgaa TCATCAATCCGCATAAGAAA atcct
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page