asnS Gene Page
Genbank name: asnS
EcoGene name: asnS
Divergent gene:
Species with an ortholog:
EC HI SP ST VC YP
EcoGene link: EG10094
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 13.87
Model logo: asnS.1.model.LGO.gif
Sequence logo: asnS.1.LGO.gif
Sequence Alignment: asnS.1.ALGN
Solution location in genomic coordinates: 988286-988307 R
Solution sequence with flanking nucleotides: gcgaa TTCTGCTTGTCTGATTGCAGAT gccag
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC HI SP ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 1
Map value: 13.55
Model logo: asnS.2.model.LGO.gif
Sequence logo: asnS.2.LGO.gif
Sequence Alignment: asnS.2.ALGN
Solution location in genomic coordinates: 988224-988247 R
Solution sequence with flanking nucleotides: tggac AAGTGTTTATTTTTTCCGACTATT aacag
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 12.66
Model logo: asnS.3.model.LGO.gif
Sequence logo: asnS.3.LGO.gif
Sequence Alignment: asnS.3.ALGN
Solution location in genomic coordinates: 988256-988279 R
Solution sequence with flanking nucleotides: ccagg TAACATAGGTATCCCCCCATTTAC gggtg
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page