aspA Gene Page

Solution location in genomic coordinates: 4366089-4366112 R
Solution sequence with flanking nucleotides: tccca AAGCGGTGATCTATTTCACAAATT aataa
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 17.00
Model logo: aspA.2.model.LGO.gif
Sequence logo: aspA.2.LGO.gif
Sequence Alignment: aspA.2.ALGN
Solution location in genomic coordinates: 4366150-4366173 R
Solution sequence with flanking nucleotides: agctt ATATTGTGGTCATTAGCAAAATTT caaga
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4366039-4366062 R
Solution sequence with flanking nucleotides: gacac TTAAAGTGATCCAGATTACGGTAG aaatc
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 16.29
Model logo: aspA.3.model.LGO.gif
Sequence logo: aspA.3.LGO.gif
Sequence Alignment: aspA.3.ALGN
Solution location in genomic coordinates: 4366113-4366135 R
Solution sequence with flanking nucleotides: tgcgc AACTATTTTTGGTAGTAATCCCA aagcg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4366082-4366104 R
Solution sequence with flanking nucleotides: cggtg ATCTATTTCACAAATTAATAATT aaggg
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page