aspC Gene Page
Genbank name: aspC
EcoGene name: aspC
Divergent gene:
Species with an ortholog:
AA EC HI PA SP ST VC YP
EcoGene link: EG10096
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 19.48
Model logo: aspC.1.model.LGO.gif
Sequence logo: aspC.1.LGO.gif
Sequence Alignment: aspC.1.ALGN
Solution location in genomic coordinates: 985066-985089 R
Solution sequence with flanking nucleotides: ccgaa AAAACAGGACTTTGGTCCTGTTTT tttta
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: aspC_ompF_IR     Overlap: 24
Species that contributed to the solution: AA EC HI ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 18.66
Model logo: aspC.2.model.LGO.gif
Sequence logo: aspC.2.LGO.gif
Sequence Alignment: aspC.2.ALGN
Solution location in genomic coordinates: 985083-985106 R
Solution sequence with flanking nucleotides: cacct CTTTGTTAAATGCCGAAAAAACAG gactt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: aspC_ompF_IR     Overlap: 9
Solution location in genomic coordinates: 985025-985048 R
Solution sequence with flanking nucleotides: cagag CAATCTCACGTCTTGCAAAAACAG cctgc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 13.71
Model logo: aspC.3.model.LGO.gif
Sequence logo: aspC.3.LGO.gif
Sequence Alignment: aspC.3.ALGN
Solution location in genomic coordinates: 984966-984986 R
Solution sequence with flanking nucleotides: taaat CTCCCGTTACCCTGATAGCGG acttc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 984939-984959 R
Solution sequence with flanking nucleotides: cttcc CTTCTGTAACCATAATGGAAC ctcgt
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page