aspS Gene Page

Genbank name: aspS
EcoGene name: aspS
Divergent gene: yecD
Species with an ortholog: AA EC HI PA SP ST TF VC YP
EcoGene link: EG10097

Species that contributed to the solution: AA EC HI SP ST TF VC YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 1
Map value: 21.60
Model logo: aspS.1.model.LGO.gif
Sequence logo: aspS.1.LGO.gif
Sequence Alignment: aspS.1.ALGN
Solution location in genomic coordinates: 1948635-1948652 R
Solution sequence with flanking nucleotides: ccagt ATAATAGCCGCCTTTTTT cattc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST TF
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 11.52
Model logo: aspS.2.model.LGO.gif
Sequence logo: aspS.2.LGO.gif
Sequence Alignment: aspS.2.ALGN
Solution location in genomic coordinates: 1948601-1948622 R
Solution sequence with flanking nucleotides: ttgtg ACATACAGCTAACGCTGCGACT tggtc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 11.11
Model logo: aspS.3.model.LGO.gif
Sequence logo: aspS.3.LGO.gif
Sequence Alignment: aspS.3.ALGN
Solution location in genomic coordinates: 1948656-1948678 R
Solution sequence with flanking nucleotides: caggc TCTTACGGTGCGGCAGAATTTCC agtat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1948593-1948615 R
Solution sequence with flanking nucleotides: ataca GCTAACGCTGCGACTTGGTCACC tgcgc
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page