asr Gene Page

Genbank name: asr
EcoGene name: asr
Divergent gene:
Species with an ortholog: EC   ST   YP   
EcoGene link: EG12149

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 14.00
Model logo: asr.1.model.LGO.gif
Sequence logo: asr.1.LGO.gif
Sequence Alignment: asr.1.ALGN
Solution location in genomic coordinates: 1669288-1669308
Solution sequence with flanking nucleotides: tacat ATCGTTACACGCTGAAACCAA ccact
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 8.36
Model logo: asr.2.model.LGO.gif
Sequence logo: asr.2.LGO.gif
Sequence Alignment: asr.2.ALGN
Solution location in genomic coordinates: 1669072-1669088
Solution sequence with flanking nucleotides: agcca ATTCCCGCAGCGCGTCT agcgt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1669354-1669370
Solution sequence with flanking nucleotides: tcaac GGCCCCGCAGTGGGGTT aa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 7.98
Model logo: asr.3.model.LGO.gif
Sequence logo: asr.3.LGO.gif
Sequence Alignment: asr.3.ALGN
Solution location in genomic coordinates: 1669260-1669278
Solution sequence with flanking nucleotides: atcaa CGCTGTAATTTATTCAGCG tttgt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1669336-1669354
Solution sequence with flanking nucleotides: cccag GGATATAGTTATTTCAACG gcccc
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page