atoD Gene Page
Genbank name: atoD
EcoGene name: atoD
Divergent gene:
Species with an ortholog:
AA EC HI PA SP
EcoGene link: EG11669
Species that contributed to the solution: AA EC HI PA SP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 10.08
Model logo: atoD.1.model.LGO.gif
Sequence logo: atoD.1.LGO.gif
Sequence Alignment: atoD.1.ALGN
Solution location in genomic coordinates: 2321375-2321390
Solution sequence with flanking nucleotides: caatt AGTTAAATAACTAAAT ccaat
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 9.95
Model logo: atoD.2.model.LGO.gif
Sequence logo: atoD.2.LGO.gif
Sequence Alignment: atoD.2.ALGN
Solution location in genomic coordinates: 2321285-2321302
Solution sequence with flanking nucleotides: cttgc TATGCAGAAATTTGCACA gtgcg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: atoC_atoD_IR     Overlap: 18
Solution location in genomic coordinates: 2321304-2321321
Solution sequence with flanking nucleotides: cacag TGCGCAATTTTCTGCATA gccgc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: atoC_atoD_IR     Overlap: 18
Species that contributed to the solution: AA EC HI PA
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 2.50
Model logo: atoD.3.model.LGO.gif
Sequence logo: atoD.3.LGO.gif
Sequence Alignment: atoD.3.ALGN
Solution location in genomic coordinates: 2321429-2321452
Solution sequence with flanking nucleotides: tgcct GACTGTACCCACAACGGTGTATGC aagag
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page