atpF Gene Page

Genbank name: atpF
EcoGene name: atpF
Divergent gene:
Species with an ortholog: AA EC HI PA SP ST TF VC YP
EcoGene link: EG10103

Species that contributed to the solution: AA EC HI PA SP ST VC
Total number of sites in the solution: 12
Number of E. coli sites in the solution: 1
Map value: 44.56
Model logo: atpF.1.model.LGO.gif
Sequence logo: atpF.1.LGO.gif
Sequence Alignment: atpF.1.ALGN
Solution location in genomic coordinates: 3918537-3918560 R
Solution sequence with flanking nucleotides: ttatt TAAAGAGCAATATCAGAACGTTAA ctaaa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI PA SP ST TF VC
Total number of sites in the solution: 11
Number of E. coli sites in the solution: 2
Map value: 23.74
Model logo: atpF.2.model.LGO.gif
Sequence logo: atpF.2.LGO.gif
Sequence Alignment: atpF.2.ALGN
Solution location in genomic coordinates: 3918562-3918580 R
Solution sequence with flanking nucleotides: TAGTAAGCGTTGCTTTTAT ttaaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3918531-3918549 R
Solution sequence with flanking nucleotides: gcaat ATCAGAACGTTAACTAAAT agagg
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page